Научный журнал
Фундаментальные исследования
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,222

АКЦЕНТУАЦИЯ ПАРАДИГМЫ «ГЕН – ОКРУЖАЮЩАЯ СРЕДА» НА ПРИМЕРЕ ХРОНИЧЕСКОГО АДЕНОИДИТА У ДЕТЕЙ

Терскова Н.В. 1 Вахрушев С.Г. 1 Шнайдер Н.А. 1 Симбирцев А.С. 2 Сидоренко Д.Р. 1
1 ГБОУ ВПО «Красноярский государственный медицинский университет имени В.Ф. Войно-Ясенецкого»
2 ФГБУ «Государственный научно-исследовательский институт особо чистых биопрепаратов» Федерального медико-биологического агентства
В статье продемонстрирован пример подтверждения совокупности фундаментальных научных представлений о влиянии факторов окружающей среды на реализацию генотипа в виде манифестации мультифакториального заболевания. Статья знакомит с результатами эпидемиолого-молекулярно-генетического исследования на примере стратифицированной кластерной выборки 47 больных детей с хроническим аденоидитом и здоровых детей. В качестве экзогенных факторов окружающей среды рассмотрено загрязнение атмосферного воздуха по количественному интегральному показателю – индексу загрязнения атмосферы. Показано селективное преимущество гетерозиготного генотипа C/T по мутантному аллелю T* гена интерлейкина-1β, как приспособление к гетерогенности среды, при проживании ребёнка с рождения в неблагоприятном по уровню загрязнения атмосферного воздуха районе. При этом частота детей, имеющих предикторный мутантный аллель Т* гена интерлейкина-4 в полиморфном локусе 589, была в 2,58 раза больше в этой группе, что объясняло манифестацию хронического аденоидита провоцирующими неблагополучными факторами окружающей среды.
хронический аденоидит
загрязнение атмосферного воздуха
полиморфизм гена интерлейкина-1β
полиморфизм гена интерлейкина-4
1. Бутаев Т. М. Гигиеническая оценка окружающей среды и состояния здоровья детского населения Республики Северная Осетия-Алания / Т.М. Бутаев, С.К. Цгоева, М.Д. Калоева // Среда обитания и здоровье детского населения : сб. науч. тр. Всерос. науч.-практ. конф. – Оренбург, 2003. – С. 49–51.
2. Дмитриев Д. А. Влияние генетических и средовых факторов на состояние системы внешнего дыхания / Д.А. Дмитриев, А.Д. Дмитриев, И.В. Сорокина // Гигиена и санитария. – 2006. – № 1. – С. 79–81.
3. Ляпин В.А. Современные тенденции формирования здоровья детского населения промышленного города / В.А. Ляпин, Н.В. Дедюлина // Здоровье населения и среда обитания. – 2005. – № 1. – С. 11–15.
4. Сливина Л.П. Антропогенная нагрузка как фактор риска формирования хронической аденотонзиллярной патологии у дошкольников / Л.П. Сливина, И.А. Молодцова // Современные проблемы охраны здоровья детей в дошкольных образовательных учреждениях: материалы Всерос. науч.-практ. конф. с междунар. участием (Москва, 1–2 ноября 2011). – М., 2011. – С. 197–200.
5. Beasley R. Worldwide variation in the prevalence of symptoms of asthma, allergic rhinoconjuctivitis and atopic eczema // Lancet. – 1998. – Vol. 351. – P. 1225–1232.
6. Genetic and environmental influences on pulmonary function in aging Swedish twins / G.E. McClearn, M. Svartengren, N. Pedersen [et al.] // J. Gerontol. – 1994. – Vol. 49, № 6. – P. 264–268.
7. Jarvis D. Epidemiology of atopy and atopic diseases / D. Jarvis, P. Burney // Allergy and allergic diseases / ed. B. Kay. – Oxford : Blackwell Science, 1997. – P. 1208–1224.
8. Pattern of genetic influence on pulmonary function / Y. Kawakami, A. Shida, H. Yamamoto [et al.] // Chest. – 1985. – Vol. 87, № 4. – P. 507–511.

В прогнозировании характера течения патологического процесса и развития осложнений, а также выбора терапии перспективным подходом является комплексный анализ факторов риска, имеющих различную природу [2].

При мультифакториальных заболеваниях (МФЗ) фенотипические признаки моделируются определённым генотипом подверженности заболеванию и воздействием факторов среды. Однако по мере увеличения возраста степень наследственной преформированности показателей уменьшается и увеличивается влияние факторов окружающей среды [6, 8]. Доказательством важности средовой компоненты является рост частоты многих МФЗ в популяциях, который невозможно объяснить изменением генетической составляющей за короткий промежуток времени с точки зрения эволюции [5, 7].

Распространённость хронического аденоидита (ХА) у детей, который относится к МФЗ, является биоиндикационным интегральным показателем качества окружающей среды. Утверждение обусловлено высоким уровнем корреляции по функциональным показателям системы внешнего дыхания. Многими авторами подтверждена высокая распространённость ХА у детей промышленных регионов [1, 3, 4]. В то же время описаны полиморфизмы генов цитокинов, предопределяющие манифестацию и неблагоприятное течение хронического воспалительного процесса в глоточной миндалине.

Многогранность взаимодействий «ген – окружающая среда» при ХА акцентируется различиями в уязвимости к неблагополучным экологическим факторам окружающей среды, определяющимися генетическими полиморфизмами. Продемонстрированный сравнительно низкий, но доказательный вклад генетической компоненты в развитие ХА, имея аддитивность с неблагоприятными факторами окружающей среды, может формировать синергетический эффект взаимодействия, значимо повышая риск развития ХА до среднего уровня, что является клинически значимым.

Цель – исследование ассоциаций генотипов и аллелей генов интерлейкина-1β (IL-1β), интерлейкина-4 (IL-4) в зависимости от района проживания ребёнка с рождения.

Материалы и методы исследования

При разделении административных районов г. Красноярска по критерию «уровень загрязнения атмосферного воздуха» как отображения качества окружающей среды нами использовался показатель – индекс загрязнения атмосферы (ИЗА). ИЗА-5 стандартизировано включал пять приоритетных загрязнителей атмосферного воздуха: бенз(а)пирен, формальдегид, взвешенные вещества, диоксид азота и аммиак. Нормативный показатель ИЗА-5 составлял менее 5 усл. ед. Методом сплошной выборки были проанализированы учётные формы за 2009–2011 гг. контроля атмосферного воздуха, предоставленные Территориальным центром по мониторингу загрязнения окружающей среды Среднесибирского межрегионального территориального управления Федеральной службы по гидрометеорологии и мониторингу окружающей среды. Учётные формы сформировали 7 карт эпидемиологического обследования в соответствии с 7 административными районами г. Красноярска.

Проведён анализ исходного состояния проблемы распространённости ХА в двух крайне противоположных по уровню ИЗА-5 районах: с относительно низким уровнем загрязнения атмосферного воздуха или благополучном по состоянию атмосферного воздуха (ИЗА = 17,97 усл. ед.) и с экстремально высоким уровнем загрязнения атмосферного воздуха или неблагополучном по состоянию атмосферного воздуха (ИЗА = 27,82 усл. ед. и более). Не было отмечено районов с нормативным значением ИЗА-5.

В ходе исследования в группах больных детей при оценке соматического здоровья были скоррелированы медико-социальные факторы, способные влиять на результат.

Для выполнения задачи была сформирована кластерная выборка 72/388 (18,6 ± 2,0) % детей-пробандов с ХА и 26/95 (27,4 ± 4,6) % здоровых детей, проживающих в разных по уровню загрязнения атмосферы районах города, обусловивших условное подразделение районов на благополучный и неблагополучный. Из данной группы детей-пробандов с ХА были приняты во внимание только те, которые имели сведения о молекулярно-генетическом типировании. Гендерное распределение и распределение по возрасту в группах было сопоставимым.

Молекулярно-генетический метод включал 2 маркёра дезоксирибонуклеиновой кислоты (ДНК) c заменой цитозина (C) на тимин (T) в полиморфных локусах двух генов: IL-1β (3954C → T), IL-4 (589С → T). Для выделения ДНК из лейкоцитов периферической крови применяли комплекты реагентов из набора «ДНК-сорб-В», изготовленным ФГУН ЦНИИЭ Роспотребнадзора (г. Москва, Россия). Генотипирование проводили методом полимеразной цепной реакции (ПЦР) в реальном времени с последующей амплификацией с использованием меченых флуоресцентными агентами олигонуклеотидных проб, комплементарных участку ПЦР-продукта (технология TaqMan) ДНК образца крови больного ребёнка с использованием методов автоматической детекции. Амплификация была выполнена в 50 µл объёме, содержащем 300 нг ДНК, 0,1 µл праймера, содержащего 16–25 пар нуклеотидов (Applied Biosystem part of Life Technologies, США). Используемые структурные дизайны праймеров для описания характеристик генов представлены согласно данным National Center for Biotechnology Information по референсу ОНП (rs – reference SNP, англ.) в соответствии с протоколом, прилагаемым к праймеру:

1) для гена IL-1β (IL-1β + 3954С/Т, rs1143634) –

CTCCACCTTTCAGAACCTATCTTCTT [C/T] GACACATGGGATAACGAGGCTTATG

2) для гена IL-4 (IL-4-589C/T, rs2243250) –

AACACCTAAACTTGGGAGAACATTGT [C/T] CCCCAGTGCTGGGGTAGGAGAGTCT.

ПЦР проводили в амплификаторе Rotor-Gene 6000 (CorbetLifeScience, Австралия).

Статистическая обработка полученных данных выполнялась при помощи:

1) компьютерной программы «SPSS v. 22.0 for Windows»;

2) методов статистической генетики ‒ с расчётом критерия отношения шансов (OR – odds ratio, англ.) и доверительного интервала (ДИ) при 95 % уровне значимости.

При нормальном распределении показателей использована описательная статистика: среднее арифметическое значение (M), стандартная ошибка среднего (m), стандартное отклонение (d). При отсутствии нормального распределения – представлены медианы (Me), 25 и 75 квартили (Q25 и Q75). При сравнении непараметрических показателей использовался критерий Вилкоксона, Мак-Нимара. Для определения значимости различий при множественном сравнении применяли критерий Крускала – Уоллиса, для попарного сравнения – критерий Манна – Уитни. Для определения статистической значимости отличий между качественными признаками применяли критерий хи-квадрат (χ2). В случае если при вычислении критерия χ2 среди ожидаемых чисел оказывались значения меньше пяти, – для определения достоверности различий использовался точный критерий Фишера. При сравнении нескольких групп применялся дисперсионный анализ с вычислением критерия Тьюки. Различия считали статистически значимыми при р < 0,05.

Результаты исследования и их обсуждение

Определены ассоциации генотипов и аллелей генов цитокинов в зависимости от района проживания с рождения у 29/72 (40,3 ± 5,8) % детей-пробандов с ХА и 18/26 (69,2 ± 9,1) % здоровых детей. Медиана возраста детей-пробандов с ХА составила 5,77 лет [4,06; 7,87]. Медиана возраста здоровых детей составила 6,26 лет [4,05; 7,72] (p > 0,05).

Из всех детей-пробандов с ХА: 12/29 (41,4 ± 9,1) % проживали в благополучном районе по уровню загрязнения атмосферы, а 17/29 (58,6 ± 9,1) % – в неблагополучном районе. Из всех здоровых детей: 7/18 (38,9 ± 11,5) % проживали в благополучном районе по уровню загрязнения атмосферы, а 11/18 (61,1 ± 11,50) % – в неблагополучном районе.

Во всех группах выявлено преобладание «дикого» аллеля C* и гомозиготного генотипа по данному аллелю С/С гена IL-1β в полиморфном локусе 3954, являющегося предикторным для изучаемого заболевания, поэтому шансы заболеть ХА были сопоставимыми. Показатель асимптоматической значимости по критерию χ2 Пирсона между больными и здоровыми детьми, проживающими в благополучном районе, составил 0,156. Показатель асимптоматической значимости по критерию χ2 Пирсона между больными и здоровыми детьми, проживающими в неблагополучном районе, составил 0,681 (табл. 1).

Возможный мутационный груз, вносимый мутантным аллелем Т* гена IL-1β в полиморфном локусе 3954, был выше в группе детей, проживающих в неблагополучном по состоянию атмосферного воздуха районе. Было констатировано статистически значимое уменьшение мутационного груза у детей-пробандов с ХА, проживающих в благополучном районе с рождения.

Интерес представлял гетерозиготный генотип по мутантному аллелю С/Т гена IL-1β в полиморфном локусе 3954, который мог отражать влияние гетерогенности внешних условий. Гипотеза состояла в том, что в популяционной системе генотипы, эволюционно адаптированные к одним условиям, при смене окружающих условий обладали меньшей устойчивостью, предрасполагая к заболеванию, в частности ХА. В указанном аспекте селективное преимущество имели гетерозиготные генотипы.

Однако дети-пробанды с ХА, проживающие в благополучном районе, за счёт меньшего мутационного груза имели меньший в 3,5 раза процент гетерозиготного генотипа по сравнению с детьми-пробандами с ХА, проживающими в неблагополучном районе. Следовательно, данная группа с одной стороны, обладала большей уязвимостью в случае смены факторов окружающей среды, с другой стороны, негативно селекционировала пул гомозиготного генотипа по «дикому» аллелю С* гена IL-1β в полиморфном локусе 3954. Несмотря на лидирование гетерозиготного генотипа по мутантному аллелю гена IL-1β в полиморфном локусе 3954 в группе детей-пробандов с ХА, проживающих в неблагополучном районе, который должен был обеспечивать селективное преимущество, манифестация заболевания реализовалась. Допустимое объяснение касалось исключительно существования и роли дополнительного фактора помимо генетической детерминируемости, который мог влиять на манифестацию заболевания, что не противоречило влиянию сверхвысокого уровня загрязнения атмосферы в неблагополучном районе.

Таблица 1

Ассоциации аллелей и генотипов гена IL-1β в полиморфном локусе 3954 с предрасположенностью к хроническому аденоидиту в исследованных группах детей, проживающих в разных по уровню загрязнения атмосферы районах

Ген цитокина, полиморфизм

Генотипы

Распределение частот генотипов n (% ± m)

Подгруппа детей с ХА

n = 29

Подгруппа здоровых детей

n = 18

Благополучный район

n = 12

Неблагополучный район

n = 17

Благополучный район

n = 7

Неблагополучный район

n = 11

IL-1β

C/C

10 (83,3 ± 10,8)

8 (47,1 ± 12,1)1

3 (42,9 ± 18,7)

7 (63,6 ± 14,5)

C/T

1 (8,3 ± 8,0)

5 (29,4 ± 11,1)1

3 (42,9 ± 18,7)

2 (18,2 ± 11,60)

T/T

1 (8,3 ± 8,0)

4 (23,5 ± 10,3)

1 (14,3 ± 13,2)

2 (18,2 ± 11,6)

C*

21 (87,5 ± 6,8)

21 (61,8 ± 8,3)1

9 (64,3 ± 12,8)

16 (72,7 ± 9,5)

T*

3 (12,5 ± 6,8)

13 (38,2 ± 8,3)1

5 (35,7 ± 12,8)

6 (27,3 ± 9,5)

Примечание. 1 – статистическая значимость различий при сравнении подгрупп детей с ХА, проживающих в разных районах, при p < 0,05.

 

При сравнении частоты генотипов и аллелей гена IL-1β в полиморфном локусе 3954 у здоровых детей, проживающих в разных районах по уровню загрязнения атмосферы, необходимо подчеркнуть, что состояние здоровья обеспечивалось, прежде всего, паритетным селективным преимуществом гетерозиготного генотипа гена IL-1β в полиморфном локусе 3954, чем влиянием факторов окружающей среды.

При расчёте показателя отношения шансов были получены значения, указывающие на существенную негативную прогностическую статистическую значимость гомозиготных генотипов по «дикому» и мутантному аллелям С/С и Т/Т соответственно гена IL-1β в полиморфном локусе 3954 в общей выборке детей, проживающих в неблагополучном районе. Напротив, при расчёте показателя отношения шансов были получены значения, указывающие на существенную положительную прогностическую статистическую значимость гомозиготного генотипа по «дикому» аллелю С/С гена IL-1β в полиморфном локусе 3954 в общей выборке детей, проживающих в благополучном районе (табл. 2).

Таблица 2

Влияние района проживания на риск развития хронического аденоидита у детей

Соотношение генотипов, аллелей гена IL-1β 3954

Отношения шансов, OR [95 % ДИ] (p ≤ 0,05)

Благополучный район

Неблагополучный район

C/C / C/T + T/T

0,15 [95 % ДИ: 0,02–1,27]

1,97 [95 % ДИ: 0,42–9,32]

T/T / C/C + C/T

1,83 [95 % ДИ: 0,10–34,48]

1,39 [95 % ДИ: 0,21–9,24]

 

Полученные результаты не противоречили ранее сделанным выводам о невыгодности гомозиготных генотипов при гетерогенности внешних условий.

Анализ распределения генотипов и аллелей гена IL-4 в полиморфном локусе 589 выявил статистически значимые различия в группе детей-пробандов с ХА по сравнению со здоровыми детьми, проживающими в неблагополучном районе (p < 0,05) (табл. 3).

     

Таблица 3

Ассоциации аллелей и генотипов гена IL-4 в полиморфном локусе 589 с предрасположенностью к хроническому аденоидиту у исследованных групп детей, проживающих в разных по уровню загрязнения атмосферы районах

Ген цитокина, полиморфизм

Генотипы

Распределение частот генотипов n (% ± m)

Подгруппа детей с ХА

n = 29

Подгруппа здоровых детей

n = 18

Благополучный район

n = 12

Неблагополучный район

n = 17

Благополучный район

n = 7

Неблагополучный район

n = 11

IL-4

C/C

7 (58,3 ± 14,2)

9 (52,9 ± 12,1)1

3 (42,9 ± 18,7)

10 (90,9 ± 8,7)1

C/T

2 (16,7 ± 10,8)

7 (41,2 ± 11,9)1

3 (42,9 ± 18,7)

1 (9,1 ± 8,7)1

T/T

3 (25,0 ± 12,5)

1 (5,9 ± 5,7)

1 (14,3 ± 13,2)

0 (0,0 ± 0,0)

C*

16 (66,7 ± 9,6)

25 (73,5 ± 7,6)1

9 (64,3 ± 12,8)

21 (95,5 ± 8,7)1

T*

8 (33,3 ± 9,6)

9 (26,5 ± 7,6)1

5 (35,7 ± 12,8)

1 (4,5 ± 8,7)1

Примечание. 1 – статистическая значимость различий при сравнении подгрупп детей с ХА и здоровых детей одного района при p < 0,05.

 

В трёх группах, кроме группы здоровых детей, проживающих в благополучном районе, выявлено преобладание аллеля «дикого» типа C* и гомозиготного генотипа по данному аллелю С/С гена IL-4 в полиморфном локусе 589, являющимися протективными для изучаемого заболевания, поэтому шансы быть здоровыми были сопоставимыми. Несмотря на меньшую частоту гомозиготного генотипа по «дикому» аллелю С/С гена IL-4 в полиморфном локусе 589 в группе здоровых детей, проживающих в благополучном районе, манифестации ХА не происходило в силу отсутствия триггерных факторов окружающей среды. В то же время при превалирующей частоте предикторного мутантного аллеля Т* и гомозиготного генотипа по мутантному аллелю Т/Т гена IL-4 в полиморфном локусе 589 в группе здоровых детей, проживающих в благополучном районе, манифестации ХА также не происходило по вышеуказанной причине. Напротив, преобладание аллеля «дикого» типа C* гена IL-4 в полиморфном локусе 589, являющемся протективным для изучаемого заболевания, обеспечивало статус здоровья у детей при проживании в неблагополучном районе, представляя, по сути, доверительный интервал по частоте – (95,5 ± 8,7) %.

Частота гомозиготного генотипа по «дикому» аллелю С/С гена IL-4 в полиморфном локусе 589 была меньше у детей-пробандов с ХА, проживающих в неблагополучном районе, чем у здоровых детей аналогичного района, и составила (52,9 ± 12,1) % против (90,9 ± 8,7) % (p < 0,05). При этом частота детей, имеющих предикторный мутантный аллель Т*, была больше, что объясняло манифестацию ХА провоцирующими неблагополучными факторами окружающей среды.

При расчёте показателя отношения шансов были получены значения, указывающие на существенную прогностическую значимость как аллеля C*, так и аллеля T* гена IL-4 в полиморфном локусе 589 в отношении риска развития ХА при проживании в неблагополучном районе (p = 0,036) (табл. 4).

Таблица 4

Влияние района проживания на риск развития хронического аденоидита у детей

Соотношение генотипов, аллелей гена IL-4 589

Отношения шансов, OR [95 % ДИ] (p < 0,05)

Благополучный район

Неблагополучный район

C/C / C/T + T/T

0,54 [95 % ДИ: 0,08–3,53]

8,89 [95 % ДИ: 0,92–85,66]

T/T / C/C + C/T

0,50 [95 % ДИ: 0,04–6,02]

1,69 [95 % ДИ: 1,23–2,31]

 

Выводы

В целом вероятность развития ХА определялась преимущественно генетической детерминируемостью. При этом значимым являлось гетерозиготное носительство как гена IL-1β, так и гена IL-4 в изученных локусах как приспособленность в гетерогенных внешних условиях среды. Экзогенный фактор окружающей среды – неблагополучное состояние атмосферного воздуха – способствовал уязвимости ребёнка-пробанда, имеющего определённый профиль гена, с манифестацией ХА, что с полной уверенностью позволяет считать их триггерными в манифестации генетической предрасположенности к ХА у детей.

Рецензенты:

Галактионова М.Ю., д.м.н., доцент, заведующая кафедрой поликлинической педиатрии и пропедевтики детских болезней с курсом последипломного образования, ГБОУ ВПО «Красноярский государственный медицинский университет имени проф. В.Ф. Войно-Ясенецкого» Министерства здравоохранения Российской Федерации, г. Красноярск;

Игнатова И.А., д.м.н., ведущий научный сотрудник лаборатории клинической патофизиологии и аллергологии, ФГБНУ «Научно-исследовательский институт медицинских проблем Севера» СО РАМН, руководитель научно-практической лаборатории «Инновационные методы обследования и коррекции сенсорных систем человека», профессор кафедры специальной психологии, ФГБОУ ВПО «КГПУ им. В.П. Астафьева», профессор кафедры ЛОР-болезней с курсом ПО, ГБОУ ВПО «КрасГМУ им. проф. В.Ф. Войно-Ясенецкого», г. Красноярск.


Библиографическая ссылка

Терскова Н.В., Вахрушев С.Г., Шнайдер Н.А., Симбирцев А.С., Сидоренко Д.Р. АКЦЕНТУАЦИЯ ПАРАДИГМЫ «ГЕН – ОКРУЖАЮЩАЯ СРЕДА» НА ПРИМЕРЕ ХРОНИЧЕСКОГО АДЕНОИДИТА У ДЕТЕЙ // Фундаментальные исследования. – 2015. – № 7-4. – С. 797-801;
URL: http://www.fundamental-research.ru/ru/article/view?id=38824 (дата обращения: 20.07.2019).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.252