Научный журнал
Фундаментальные исследования
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,087

ХАРАКТЕРИСТИКА ПОВЕДЕНИЯ КРЫС, РАЗЛИЧАЮЩИХСЯ ПО ГЕНОТИПУ ЛОКУСА TAG 1A ГЕНА РЕЦЕПТОРА ДОФАМИНА ВТОРОГО ТИПА, В ТЕСТЕ «ПРИПОДНЯТЫЙ КРЕСТООБРАЗНЫЙ ЛАБИРИНТ»

Н.Ф. Леушкина, А.В. Ахмадеев, Л.Б. Калимуллина
В работе впервые приведены сведения об особенностях поведения двух групп крыс, гомозиготных по двуаллельному локусу TAG 1A DRD2, в установке «приподнятый крестообразный лабиринт».
поведение
приподнятый крестообразный лабиринт
дофаминергическая система

Участие дофаминергической системы мозга в реализации многообразных функций объясняет ее вовлечение в патогенез многих психоневрологических заболеваний, включая и социально значимые, к которым относится эпилепсия. Эпилепсия является наиболее распространенным заболеваниям нервной системы, так как заболеваемость ею составляет 50-70 случаев на 100 тыс. человек, у 20-30% больных заболевание является пожизненным.

Крысы линии WAG/Rij являются инбредной линией с генетически детерминированной абсансной эпилепсией. Они широко используются в качестве адекватной модели для изучения механизмов генерализованной абсансной эпилепсии человека [4], причины возникновения которой остаются до настоящего времени неизвестными. Важным звеном в патогенезе абсансной эпилепсии является дефицит дофаминергической системы, при этом ведущее значение имеет изменение уровня функционирования дофаминовых рецепторов второго типа (DRD2) [5].

Целью данной работы является характеристика поведения двух групп крыс линии WAG/Rij, различающихся генотипом по локусу TAG 1A гена DRD2, в установке «приподнятый крестообразный лабиринт» (ПКЛ). ПКЛ является наиболее признанным тестом при оценке уровня тревожности у грызунов [1,7,10] и часто используется при изучении анксиолитиков. Основанием для проведения эксперимента послужили результаты тестирования поведения этих крыс в «открытом поле», показавшие у них признаки тревожного поведения [2].

Для генетического анализа ДНК (анализ выполнен совместно с Э.К. Хуснутдиной и А Галеевой) была выделена из лимфоцитов периферической крови. Для получения ДНК использовали метод Мэтью [8]. Для этого кровь с консервантом в пробирке тщательно перемешивали и переливали в 100 мл центрифужный стакан, туда же добавляли 50 мл охлажденного лизирующего буфера, содержащего 320 мМ сахарозы, 1%-ный раствор тритона Х-100, 5 мМ MgCl2, 10мМ трис HCl, pH 7,6. Смесь центрифугировали 20 мин. при 4000 об./мин. Надосадочную жидкость сливали, а к получившемуся осадку приливали 8 мл буфера ЭДТА(25 мМ ЭДТА, 75 мМ NaCl), pH 8.0, суспендировали. К суспензии добавляли 0,8 мл 10% SDS и протеинкиназу К (10мг/ мл). Смесь для лизиса оставляли на ночь в термостате при температуре 42° С. Экстракцию ДНК осуществляли в следующем порядке: 1.Для депротеинизации к лизату добавляли 0,5 мл 5М перхлората натрия и 8 мл фенола, насыщенного 1М трисHCl до pH 7.8; 2.Смесь центрифугировали при 3000 об./мин. в течение 10 мин.; 3.Отбирали водную фазу, содержащую ДНК, РНК и неденатурированные белки; 4. Отобранную фазу обрабатывали смесью фенол-хлороформа (1:1), а затем хлороформом; 5. Препараты осаждали двумя объемами 96% этанола; 6. Образовавшийся осадок ДНК растворяли в 1,5 мл деионизированной воды; раствор хранили при -20° С. Амплификацию локуса TAG 1a DRD2 проводили с помощью метода полимеразной цепной реакции синтеза ДНК (ПЦР) на амплификаторе «Терцик» производства г.Пущино с использованием ДНК-полимеразы Termus aguaticus производства фирмы «Биотекс» (Москва). Реакционная смесь для амплификации состояла: из 0,1-1 мкг геномной ДНК, 0,25 мкМ каждого олигопраймера, 250 мкМ каждого дезоксинуклеозидтрифосфата помещали в 25 мкл однократного буфера для ПЦР следующего состава: 67 мM трисHCl, pH 8.8, 6,7 мМ MgCl2, 16,6 мМ (NH4)2SO4, 0,01% Tween-20.

ПЦР локуса TAG 1A (локализован в 3´- некодирующем регионе) DRD2 проводили с использованием олигонуклеотидных праймеров:

5´ CTGGGTATCGTCCACCTTCT 3´

5´ AACACTGCTACACCTAATCATCCA 3´, подобранных с помощью программы Primer 3 (http://frodo.wi.edu/primer3).

После денатурации (3 мин. при 94°С) выполняли 35 циклов амплификации по схеме: отжиг праймеров - 1 мин. при 58°С, синтез ДНК - 1 мин. при 72°С, денатурация - 1 мин. при 94°С. Затем пробы выдерживали 10 мин. при 72°С, охлаждали [6]. Для выявления полиморфизма 10 мкл реакционной смеси обрабатывали 5 единицами рестриктазы TAG 1A. В результате реакции аллель А1 локуса TAG 1A длиной 295 пар оснований оставался интактным, а аллель А2 подвергалась ферментативному гидролизу. Длины фрагментов аллеля А2 были равны 119 и 176 парам оснований.

Результаты амплификации оценивали в полиакриламидном геле (ПААГ). Для разделения амплифицированных фрагментов использовали 7%-ный гель [3]. Для заливки ПААГ готовили раствор, состоящий из 5,5 мл 30%-ного раствора акриламида, 2,5 мл 10*трис-боратного буфера - ТBE и 17 мл дистиллированной воды. Непосредственно перед заливкой геля в раствор добавляли 29 мкл 10%-ного персульфата аммония и 15 мкл N,N,N´,N´ тетраметилэтилендиамина - ТЕМЕД. ПААГ заливали между двумя стеклами, разделенными прокладками и гребенкой, и оставляли для полимеризации на 20 мин. Затем вынимали гребенку, промывали образовавшиеся лунки водой и помещали гель в вертикальную электрофорезную камеру. В качестве электрофорезного буфера использовали 1*ТВЕ. Проводили префорез в течение 20 минут.

Пробы для нанесения в гель готовили следующим образом: 10 мкл амплификата смешивали с 2 мкл краски (смесь бромфенолового синего и ксилолцианола). Наносили приготовленные пробы в лунки и проводили электрофорез в течение 1,5 часов при 300 В. В качестве маркера молекулярного веса использовали 2-Log Ladder (0,1 - 10,0 кб) (New England Biolabs, США). После окончания электрофореза гель окрашивали раствором бромистого этидия и визуализировали в проходящем ультрафиолетовом свете. Документирование результатов электрофореза проводили с использованием видеосистемы «Geldokulant» (Франция).

ПКЛ, использованный в работе, представлял собой установку, имеющую два рукава, в месте пересечения которых находилась открытая площадка. Один из рукавов лабиринта имел закрытые отсеки. Лабиринт устанавливали на высоте одного метра от пола. Изучая поведение крыс, мы регистрировали в течение пяти дней ряд параметров: количество посещений и время пребывания в открытых и закрытых рукавах, количество стоек в открытом и закрытом рукавах, количество свешиваний с открытого рукава, число эпизодов и продолжительность груминга, общую неподвижность, количество болюсов. Полученные результаты систематизировали и подвергали статистической обработке с помощью пакета программ «Statistica 5,5».

Поведенческие реакции изучены у 121 крысы, 75 которых имели генотип А1/А1 по локусу TAG 1a DRD2 (далее в работе они будут обозначены как группа А1А1), 46 - с генотипом А2/А2 по тому же локусу (группа А2А2).

Полученные результаты приведены в таблицах 1 и 2.

Таблица 1

Показатели предпочтения крысами открытого или закрытого рукавов лабиринта и груминга 

Группы крыс

Количество посещений

Время пребывания

Груминг (длительность)

ОР

 ЗР

ОР

ЗР

ОР

ЗР

А1А1

4,10

+0,16

4,27

+0,16

147,89

 +5,33

152,11

+5,20

1,85

+0,28

4,19

+0,78

А2А2

0,96

 +0,21

1,38

+0,20

90,26

+7,53

209,74

+7,52

2,38

+0,33

4,38

+0,47

p

<0,001

<0,001

<0,001

<0,001

>0,05

>0,05

Обозначения: ОР - открытый рукав (светлый отсек); ЗР - закрытый рукав (темный отсек)

Приведенные в табл. 1 данные показывают, что животные, гомозиготные по аллелю А2 в локусе TAG 1A DRD2 по сравнению с другой группой (А1А1), в четыре раза меньше посещают как открытые, так и закрытые рукава. При этом время, проведенное ими в закрытом рукаве, в два раза больше, чем в открытом, т.е. меньше перемещаясь по сравнению с крысами А1А1 из одного рукава в другой, они надолго остаются в закрытом рукаве. Если рассчитать время, проведенное крысами А2А2 в закрытом рукаве на одно его посещение, оно окажется примерно равным 152 секундам, в то время как этот же показатель в отношении светлого отсека значительно меньше и равен 94 секундам. Различия по времени пребывания крысами группы А2А2 в открытом и закрытом рукавах высокозначимы (p<0,001).

Таблица 2

Показатели исследовательской деятельности крыс в приподнятом крестообразном лабиринте 

Группы крыс

Количество вертикальных стоек в рукавах

Количество свешиваний в ОР

открытый

 закрытый

А1А1

6,14+0,42

7,63+0,43

14,26+0,68

А2А2

3,53+0,57

5,33+0,34

6,07+0,61

p

<0,001

<0,001

<0,001

Подобный анализ в отношении крыс А1А1 показывает, что среднее время их пребывания в открытом и закрытом рукавах на одно его посещение равно между собой и составляет 36 секунд. Статистический анализ вариационных рядов, выстроенных по численным характеристикам количества посещений светлого и темного отсеков лабиринта, а также по времени, проведенному в них, показывает отсутствие значимых различий, так как критерий Стьюдента в обоих случаях соответственно составляет t=0,73, p=0,46 и t=0,78, p=0,44. Полученные данные позволяют указать на интересную особенность поведения крыс А1А1, а именно: отсутствие у них «способности» различать темный и светлый отсеки лабиринта, посещение которых напоминает челночные движения из одного в другой. Можно было бы предположить, что отмеченный феномен связан с нарушениями в светочувствительности сетчатки глаза этих крыс (известно, что у крыс линии WAG/Rij может иметь место пигментная ретинопатия [9]. Однако против этого говорит выявленный в работе факт предпочтения для проведения груминга крысами А1А1 закрытого рукава лабиринта (p<0,001, см.ниже). Поэтому следует думать, что высокая локомоторная активность крыс А1А1 связана с особенностями процессов дофаминергической трансмиссии. Паттерн поведения крыс А1А1 напоминает картину, описанную в литературе как синдром гиперактивности/дефицита внимания, который часто встречается в детском возрасте и объясняется как следствие нарушений, предопределенных генетическими факторами в функционировании особых белков - переносчиков дофамина [11].

Сравнение длительности и количества эпизодов груминга у крыс А1А1 и А2А2 не выявило статистически значимых различий, но обращало на себя внимание явная тенденция, общая для обеих групп крыс, проводить груминг в закрытом рукаве. Проведенное сравнение по показателям груминга внутри групп изучаемых крыс показало, что по выраженности «чесательного» рефлекса в открытом и закрытом рукавах ПКЛ в каждой группе крыс существуют значимые различия (у крыс А1А1 при р<0,05, у крыс А2А2 при р<0,01). Это указывает на то, что темный отсек является более комфортным для реализации «чесательного рефлекса».

Показателями исследовательской деятельности в приподнятом крестообразном лабиринте являются как количество совершаемых животными стоек, так и процедура свешивания крысы с открытого рукава, когда она с высоты, на которой находится лабиринт, осматривает пространство, расположенное под рукавом лабиринта. Учитывая существующую у крыс боязнь высоты, этот же показатель может рассматриваться и как проявление меньшей тревожности. Эти данные в сравнительном аспекте в отношении двух групп крыс отражены в табл. 2.

Из данных табл. 2 следует, что крысы А1А1 проявляют большую исследовательскую активность по сравнению с крысами А2А2 как в закрытых, так и в открытых рукавах (p<0,001). Кроме того, выявлены высокозначимые различия между изучаемыми группами крыс и по показателю «свешивания в открытом рукаве» лабиринта. Если рассматривать этот показатель в аспекте проявления тревожности, то можно сказать, что крысы А2А2 значительно более тревожны по сравнению с крысами группы А1А1. Анализ показателей поведения крыс в ПКЛ внутри изучаемых групп по выраженности исследовательской деятельности показал, что она более ярко проявляется в закрытом рукаве (темном отсеке), при этом выявленные различия значимы у крыс А1А1 при р<0,05, у крыс А2А2 при р<0,01.

Итак, полученные в работе данные показывают большую тревожность крыс с генотипом А2/А2 по сравнению с крысами с генотипом А1/А1 по локусу TAG 1A DRD2.

Список литературы

  1. Дыгало Н.Н. // Успехи физиол. наук. - 2007, Т. 38, № 1. - С. 3.
  2. Леушкина Н.Ф., Калимуллина Л.Б. // Успехи современного естествознания. - 2008. - №9, С. 10.
  3. Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генетической инженерии. Молекулярное клонирование. - М.: Мир, 1984. - 399 c.
  4. Меерен Х.К.М., ван Луителаар Е.Л.Дж., да Сильва Ф.Х.Лопес и др.// Успехи физиологических наук. - 2004. - Т. 35, № 1. - С. 3.
  5. Мидзяновская И.С., Кузнецова Г.Д., Туомисто Л. и др. // Нейрохимия. - 2004, Т. 21, № 4. - С.264.
  6. Chen W.J., Lu M.-L., Hsu Y.-P. et al. // American Journal of Medical Genetics. - 1997. V. 74. - P. 129.
  7. Holmes A. // Neuirosci Biobehav Rev. - 2001, V. 25. - P. 261.
  8. Mathew С. Methods in Molecular Biology / Ed. Walker J.M. - New York.: Human Press, 1984. - V. 2. - P. 31.
  9. O´Steen W.K., Donnelly J.E. // Invest Ophthalmol Vis. Sci. - 1982. - V. 22. - N 252. - P. 5.
  10. Pellow S., Chopin P., File S.E. et al. // J. Neurosci Methods. - 1985. - V. 14. - P. 149.
  11. Steyaert J., Devriendt K., Fryns J. // Am. J. Med. Genet. - 1997. - V. 74, - N 6. - P. 656.

Библиографическая ссылка

Н.Ф. Леушкина, А.В. Ахмадеев, Л.Б. Калимуллина ХАРАКТЕРИСТИКА ПОВЕДЕНИЯ КРЫС, РАЗЛИЧАЮЩИХСЯ ПО ГЕНОТИПУ ЛОКУСА TAG 1A ГЕНА РЕЦЕПТОРА ДОФАМИНА ВТОРОГО ТИПА, В ТЕСТЕ «ПРИПОДНЯТЫЙ КРЕСТООБРАЗНЫЙ ЛАБИРИНТ» // Фундаментальные исследования. – 2010. – № 1. – С. 65-69;
URL: http://www.fundamental-research.ru/ru/article/view?id=1615 (дата обращения: 28.02.2020).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074