Научный журнал
Фундаментальные исследования
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,087


Левчук Л.А. 1 Лосенков И.С. 1 Вялова Н.М. 1 Шмиголь М.В. 1 Лебедева Е.В. 1 Симуткин Г.Г. 1 Иванова С.А. 1
1 ФГБУ «Научно-исследовательский институт психического здоровья» Сибирского отделения Российской академии медицинских наук
Проведено исследование распределения генотипов полиморфного варианта Cys23Ser гена рецептора 2С серотонина (HTR2C) у пациентов с депрессивными расстройствами в рамках F31-F34 (МКБ-10) и психически и соматически здоровых людей. Исследование распределения частот генотипов HTR2C в обследованных группах показало преобладание в обеих группах гомозиготного генотипа GG, наиболее редким был гомозиготный генотип СС. По частоте встречаемости аллелей в исследуемых группах преобладал аллель G. Статистический анализ полученных результатов выявил значимые различия в распределении гомозиготных генотипов CC и GG среди пациентов с депрессивными расстройствами и психически здоровых людей (Х2 = 2,899; р = 0,044; OR = 2,75). Показаны значимые различия в распределении частот аллелей С и G между группой пациентов с депрессивными расстройствами и здоровыми лицами (Х2 = 5,142; р = 0,012; OR = 2,012). Полиморфизм Cys23Ser гена рецептора 2С серотонина (HTR2C) вносит определенный вклад в эндофенотип депрессивных расстройств.
рецептор серотонина 2C
депрессивные расстройства
1. Гайсина А.А. Генетические факторы риска суицидального поведения / А.А. Гайсина, З.Л. Халилова, Э.К. Хуснутдинова // Журнал неврологии и психиатрии им. С.С. Корсакова. – 2008. – Т.108. – № 1. – С. 87–91.
2. Краснов В.Н. Психосоматические аспекты расстройств аффективного спектра: клинические и организационные проблемы / В.Н. Краснов // Психические расстройства в общей медицине. – 2012. – № 2. – С. 12–15.
3. Левчук Л.А. Cеротонинергическая система в патогенезе и терапии депрессивных расстройств (обзор литературы) / Л.А. Левчук, М.В. Шмиголь, С.А. Иванова // Сибирский вестник психиатрии и наркологии. – 2012. – № 2. – С. 75–79.
4. Рядовая Л.А. Изучение полиморфных вариантов гена рецептора серотонина типа 2А 5-HTR2A при пограничных психических расстройствах / Л.А. Рядовая, Е.В. Гуткевич, О.М. Лаврушина, С.А. Иванова, В.Я. Семке // Сибирский вестник психиатрии и наркологии. – 2007. – № 4. – С. 12–15.
5. Фасхутдинова Г.Г. Молекулярно-генетическое изучение зависимости от психоактивных веществ: автореф. дис. … канд. биол. наук. – Уфа, 2010. – 24 с.
6. Brummett B.H. Cortisol responses to emotional stress in men: association with a functional polymorphism in the 5HTR2C gene / B.H. Brummett, C.M. Kuhn, S.H. Boyle, M.A. Babyak, I.C. Siegler, R.B. Williams // Biol Psychol. – 2012. – № 89. – Vol.1. – P. 94–98.
7. Fentress H.M. Pharmacological properties of the Cys23Ser single nucleotide polymorphism in human 5-HT2C receptor isoforms / H.M. Fentress, E. Grinde, J.E. Mazurkiewicz, J.R. Backstrom, K. Herrick-Davis and E. Sanders-Bush // The Pharmacogenomics Journal. – 2005. – № 5. – P. 244–254.
8. Hadithy A.F.Y. Al. Tardive dyskinesia and DRD3, HTR2A and HTR2C gene polymorphisms in Russian psychiatric inpatients from Siberia / Hadithy A.F.Y. Al, Ivanova S.A., Pechlivanoglou P., Semke A., Fedorenko O., Kornetova E., Ryadovaya L., Brouwers J.R.B.J., Wilffert B., Bruggeman R., Loonen A.J.M. // Progress in Neuro-Psychopharmacology & Biological Psychiatry. – 2009. – № 33. – P. 475–481.
9. Heisler L.K. Serotonin 5-HT2C receptors regulate anxiety-like behavior / L.K. Heisler, L. Zhou, P. Bajwa, J. Hsu, L.H. Tecott // Genes, Brain and Behaivior. – 2007. – № 6. – Vol. 5. – P. 491–496.
10. Iwamoto K. Altered RNA editing of serotonin 2C receptor in a rat model of depression / K. Iwamoto, N. Nakatani, M. Bundo, T. Yoshikawa, T. Kato // Neurosci Res. – 2005. – № 53. – Vol.1. – P. 69–76.
11. Lappalainen J.H. HTR2C Cys23Ser polymorphism in relation to CSF monoamine metabolite concentrations and DSM-III-R psychiatric diagnoses / J. Lappalainen, J.C. Long, M. Virkkunen, N. Ozaki, D. Goldman, M. Linnoila // Biol Psychiatry. – 1999. – № 46. – P. 821–826.
12. Massat I. HTR2C (Cys23Ser) polymorphism influences early onset in bipolar patients in a large European multicenter association study / I. Massat, B. Lerer, D. Souery, D. Blackwood, W. Muir, R. Kaneva, M.M. Noethen, L. Oruc, G.N. Papadamitriou, D. Dikeos, A. Serretti, F. Bellivier, J.L. Golmard, V. Milanova, J. Del-Favero, C. Van Broeckhoven, J. Mendlewicz // Mol. Psychiatry. – 2007. – №  12. – P. 797–798.
13. Van Heeringen K. The neurobiology of suicide and suicidality / K. Van Heeringen // Can J Psychiat. – 2003. – № 48 (5). – P. 292–300.
14. Videtic A. Promoter and functional polymorphisms of HTR2C and suicide victims // A. Videtic, T.T. Peternelj, T. Zupanc, J. Balazic, R. Komel // Genes Brain Behav. – 2009. – № 8. – Vol.5. – P. 541–545.
15. Zubenko G.S. Genome-wide linkage survey for genetic loci that affect the risk of suicide attempts in families with recurrent, early-onset, major depression / G.S. Zubenko, B.S. Maher, H.B. Hughes et al. // Am J Med Genet B Neuropsychiatr Genet. – 2004. – № 129 (1). – P. 47–54.

В последние годы особое место отводится изучению генеза депрессивных расстройств, что связано с ростом распространенности депрессивных расстройств во всех возрастных группах, увеличением их влияния на жизнь общества в целом, влиянием на трудоспособность, высокой степенью их коморбидности с соматическими заболеваниями, а также наибольшим среди психических расстройств риском суицидального поведения [2]. Однако, несмотря на высокое медико-социальное значение патологии аффективного спектра, до сих пор нет ясных представлений о причинах и механизмах развития депрессивных расстройств.

В настоящее время считается наиболее обоснованным, что ключевые патогенетические механизмы депрессивных расстройств связаны с нарушениями ряда нейрохимических систем, в том числе дисрегуляцией серотонинергической системы. Депрессивные расстройства сопровождаются уменьшением активности серотонинергической системы, а также взаимодействиями полиморфных локусов генов серотонинового обмена, детерминирующими предрасположенность к развитию аффективных расстройств [3]. Наследственная предрасположенность играет значительную роль в формировании психических расстройств, факторы социальной среды определяют факт возникновения психической дезадаптации, а форма реагирования, психопатологическая картина и течение заболевания определяются патологическим генотипом. В проведенных нами ранее исследованиях [4] показана ассоциация локуса Т102С гена рецептора серотонина типа 2А 5-HTR2A с расстройствами адаптации с преобладанием депрессивных реакций и локуса A-1438-G этого же гена с диссоциативными расстройствами.

Серотонинергическая система мозга представлена многочисленными нейронами ядер центрального серого вещества, шва ствола, среднего мозга и широкой сетью аксонов, проецирующихся в различные структуры головного и спинного мозга. 5-НТ2С рецепторы обнаружены в наибольшем количестве в хориоидальном сплетении, гиппокампе, коре головного мозга, полосатом теле, черной субстанции. Обнаружение очень высоких уровней этих рецепторов в сосудистых сплетениях послужило основанием предположить, что они могут регулировать церебральную продукцию спинномозговой жидкости. Показано, что 2C рецепторы контролируют выброс других нейромедиаторов, в частности, нор­адреналина и допамина. HT2C рецепторы участвуют в регуляции настроения, тревоги, сна, аппетита, сексуальных функций, сердечно-сосудистой системы [9].

Показана ассоциация локуса Cys23Ser гена 5-НТ2С c большим депрессивным и биполярным расстройством [12], суицидным поведением [14], тардивной дискинезией при шизофрении [8], алкоголизмом и опийной наркоманией [5]. Ген 5-HT2C является не только функциональным, но и позиционным геном-кандидатом суицидального поведения [1]. Недавно опубликованные результаты полногеномного сканирования свидетельствуют о функциональной значимости региона Xq25-26.1, в пределах которого локализован данный ген, для риска попыток суицида у лиц с униполярной депрессией [15].

Таким образом, дефицит серотонинергической медиации может быть важным патофизиологическим механизмом депрессии. Согласно К. Van Heeringen [13], депрессивное поведение является процессом, разворачивающимся при взаимодействии факторов, влияющих на черты личности, и факторов, влияющих на состояние личности, изменения серотонинергической системы могут представлять собой биологическую основу черт личности, предрасполагающих к депрессивным расстройствам.

Целью настоящей работы явилось изу­чение частот полиморфизма гена рецептора 2С серотонина (HTR2C) у пациентов с депрессивными расстройствами и психически здоровых лиц.

Материалы и методы исследования

Клинико-биологическое исследование было проведено в группе пациентов с текущей депрессией в рамках F31-F34, МКБ-10 (22 мужчины, средний возраст которых составил 53 ± 10,3 лет; 72 женщины, средний возраст этих пациентов составил 51,6 ± 10,6 лет). Далее эта группа будет именоваться «пациенты с депрессивными расстройствами». Пациенты с депрессивной симптоматикой проходили курс лечения в отделении аффективных состояний клиник НИИПЗ СО РАМН. Контрольную группу составили психически и соматически здоровые лица (29 мужчин, средний возраст – 42 ± 13,8 лет; 62 женщины, средний возраст которых 33 ± 13 лет), не имеющие хронических заболеваний и не стоящие на диспансерном учете, без признаков перенесенных острых инфекционных заболеваний на момент обследования.

Кровь для биологических исследований у пациентов и психически здоровых лиц забирали из локтевой вены, утром, натощак. Группа исследуемых сформирована из этнически русских лиц, не состоящих в кровном родстве.

Генетические исследования проводились согласно этическим принципам медицинской генетики, в соответствии с Хельсинской декларацией Всемирной ассоциации «Этические принципы проведения научных медицинских исследований с участием человека» с поправками 2000 г. и правилами клинической практики в РФ, утвержденными Приказом Минздрава РФ от 19.06.2003 г. № 266. Исследование проводилось на базе лаборатории клеточных и молекулярно-биологических исследований ФГБУ «НИИПЗ» СО РАМН (руководитель лаборатории – д-р мед. наук, профессор С.А. Иванова).

Для генотипирования использовали набор реагентов TaqMan® SNP Genotyping Assay фирмы Applied Biosystems (США). Определение аллельных вариантов гена HTR2C rs6318 проводили методом полимеразно-цепной реакции (ПЦР) в реальном времени со специфическими праймерами, результаты реакции детектировали с помощью флуоресцентных Taq-man зондов, комплиментарных полиморфному участку ДНК CTAATTGGCCTATTGGTTTGGCAAT[C/G]TGATATTTCTGTGAGCCCAGTAGCA.

Амплификацию ДНК проводили в объеме реакционной смеси, равной 20 мкл и содержащей 1 мкл ДНК матрицы и 19 мкл реакционной смеси набора в следующем режиме: первичный прогрев и регистрация флуоресцентных сигналов – 30 с при 60 °С; начальная денатурация – 10 мин при 95 °С; затем 60 циклов: денатурация – 15 с при 95 °С; отжиг – 15 с при 60 °С для пар праймеров HTR2C rs6318; элонгация – 45 с при 60 ºС; регистрация флуоресцентных сигналов – 15 с при 60 °С; после чего конечная элонгация и регистрация флуоресцентных сигналов в конечной точке – 30 с при 60 °С. Для проведения полимеразно-цепной реакции использовали Real-Time ДНК амплификатор «StepOnePlus» фирмы Applied Biosystems (США). Статистическая обработка результатов проводилась с использованием пакета программ SPSS для Windows, версия 15.0. Для проверки соответствия распределения частот генотипов исследуемого гена равновесному распределению Харди−Вейнберга использовался модифицированный критерий χ². Сравнение частот генотипов и аллелей анализируемых групп проводили с помощью критериев χ2, Фишера. Различия считали достоверными при р < 0,05.

Результаты исследования и их обсуждение

Распределение частот генотипов в исследованных группах не подчиняется закону Харди−Вайнберга (таблица), что объясняется локализацией гена HTR2C на Х хромосоме в регионе Xq24.

Распределение частот генотипов гена рецептора 2С серотонина (HTR2C) и соответствие распределению Харди–Вайнберга (χ2) в исследуемых группах

Исследуемые группы














Пациенты с депрессивными расстройствами


10 (10,6)

14 (14,9)

70 (74,5)





χ2 = 23,2; P = 0,0001

Психически и соматически здоровые лица


4 (4,4)

10 (11)

77 (84,6)





χ2 = 10,4; Р = 0,001

Примечание. N – число обследованных, в скобках – частота встречаемости, %.

Исследование распределения частот генотипов HTR2C в обследованных группах показало преобладание гомозиготного генотипа GG, в группе лиц с депрессивными расстройствами частота GG составила 74,5 %; в группе здоровых людей – 84,6 %. Вторым по частоте встречаемости был гетерозиготный генотип (14,9 и 11 % соответственно). Наиболее редким был гомозиготный генотип СС. В группе лиц с депрессивными расстройствами этот генотип обнаружен у 10,6 % пациентов, в группе психически и соматически здоровых людей – 4,4 %.

По частоте встречаемости аллелей в исследуемых группах преобладал аллель G, так, в группе лиц с депрессивными расстройствами частота этого аллеля составила 81,9 %, в выборке здоровых людей – 90,1 %. Минорный аллель С в группе пациентов составил 18,1 %, в группе психически здоровых лиц – 9,9 %.

Сравнительный анализ распределения частот генотипов полиморфного маркера гена рецептора 2С серотонина (HTR2C) представлен на рис. 1. Анализ результатов генотипирования по полиморфному локусу HTR2C не выявил статистических различий распределения генотипов между группой пациентов с депрессивными расстройствами и контролем (Х2 = 3,52; р = 0,17). При попарном сравнении частот генотипов в исследуемых группах обнаружены значимые различия в распределении гомозиготных генотипов CC и GG среди пациентов с депрессивными расстройствами и психически здоровых людей (Х2 = 2,899; р = 0,044). Показатель отношения шансов, которое показывает во сколько раз риск развития данной патологии выше у носителей определенного генотипа, составил OR = 2,75.


Рис. 1. Сравнительный анализ распределения частот генотипов локуса HTR2C гена рецептора серотонина в исследуемых группах:* – p < 0,05 по сравнению с психически здоровыми лицами

Оценка распределения частот аллелей гена HTR2C между исследуемыми выборками (рис. 2) показала значимые различия в распределении частот аллелей между группой пациентов с депрессивными расстройствами и здоровыми лицами (Х2 = 5,142; р = 0,012; OR = 2,012).

Таким образом, при исследовании полиморфизма гена рецептора 2С серотонина (HTR2C) выявлено значимое снижение частоты встречаемости гомозиготного генотипа GG и аллеля G среди пациентов с депрессивными расстройствами по сравнению с психически здоровыми лицами. Известно, что экспрессия гена HTR2C с аллелем HTR2C*C в локусе rs6318 (Cys23Ser) приводит к образованию белка, имеющего в 2 раза более низкую аффинность к серотонину [11]. Исследование K. Iwamoto et al. [10] показало, что полиморфизм гена HTR2C участвует в патогенезе депрессии и действии антидепрессантов. B.H. Brummett et al. [6] заключили, что полиморфизм 5HTR2C ассоциирован с активацией гипоталамо-гипофизарной оси, зависимой от эмоционального стресса, психологических и физиологических особенностей, которые повышают риск возникновения сердечно-сосудистых заболеваний и диабета 2 типа. Показано, что для жертв самоубийств женского пола характерно преобладание гомозиготного генотипа GG и аллеля G [14]. Показана ассоциация аллеля С с большим депрессивным и биполярным аффективным расстройством [12]. В исследовании H.M. Fentress [7] выявлена связь присутствия минорного аллеля С со сниженным уровнем бессонницы и наличием психосоматических заболеваний у пациентов с депрессивными расстройствами. Генотипирование по исследуемому локусу показало значимое повышение частоты минорного аллеля С в группе пациентов с депрессивными расстройствами по сравнению с психически здоровыми людьми. В связи с полученными результатами и данными современных исследований можно предположить существование непосредственной связи между полиморфизмом Cys23Ser и депрессивными расстройствами, однако необходимо учитывать факты взаимодействия генов и вклад каждого из них в развитие психических расстройств.


Рис. 2. Сравнительный анализ распределения частот аллелей локуса HTR2C гена рецептора серотонина в исследуемых группах:* – p < 0,05 по сравнению с психически здоровыми лицами


В результате нашего исследования выявлено значимое повышение частоты встречаемости гомозиготного генотипа СС и минорного аллеля С гена рецептора 2С серотонина (HTR2C) среди пациентов с депрессивными расстройствами по сравнению с психически здоровыми людьми. Полученные результаты согласуются с данными исследований, проведенных в последние годы, и подтверждают участие серотонинергической системы в патогенезе депрессивных расстройств. В то же время депрессивные расстройства относятся к мультифакторным заболеваниям, развитие которых зависит от взаимодействия определенных комбинаций аллелей разных локусов и специфических воздействий факторов окружающей среды, и отдельные полиморфизмы вносят определенный вклад в эндофенотип депрессивных расстройств.

Работа выполнена при поддержке Российского гуманитарного научного фонда (проект № 11-36-00213) «Серотониновая система в модуляции агрессивного и депрессивного поведения: разработка новых подходов к прогнозированию, диагностике и лечению психических расстройств».


Балашов П.П., д.м.н., профессор, заведующий кафедрой психиатрии, наркологии, психотерапии ГБОУ ВПО «Сибирский государственный медицинский университет» Министерства здравоохранения и социального развития Российской Федерации;

Невидимова Т.И., д.м.н., профессор кафедры нормальной физиологии ГБОУ ВПО «Сибирский государственный медицинский университет» Министерства здравоохранения и социального развития Российской Федерации.

Работа поступила в редакцию 28.11.1012.

Библиографическая ссылка

Левчук Л.А., Лосенков И.С., Вялова Н.М., Шмиголь М.В., Лебедева Е.В., Симуткин Г.Г., Иванова С.А. АССОЦИАЦИЯ ПОЛИМОРФИЗМА ГЕНА РЕЦЕПТОРА СЕРОТОНИНА 2С (HTR2C) С ДЕПРЕССИВНЫМИ РАССТРОЙСТВАМИ // Фундаментальные исследования. – 2013. – № 1-2. – С. 299-303;
URL: http://www.fundamental-research.ru/ru/article/view?id=30940 (дата обращения: 15.08.2020).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074