Научный журнал
Фундаментальные исследования
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,074

ИССЛЕДОВАНИЕ ЭФФЕКТА ПОВЫШЕННОГО ОБРАЗОВАНИЯ ГАММА-СИНУКЛЕИНА НА ДЕГЕНЕРАЦИЮ СИНАПСОВ, ВЫЗВАННУЮ НАРУШЕНИЕМ ФУНКЦИИ БЕЛКА CSPα

Лыткина О.А. 1 Тарасова Т.В. 1 Анохин П.К. 1 Кухарский М.С. 1 Устюгов A.A. 1 Бачурин С.О. 1
1 Институт физиологически активных веществ Российской академии наук
Создана и охарактеризована новая линия мышей с повышенным синтезом белка гамма-синуклеина в тканях нервной системы на фоне генетического нокаута CSPα, являющимся ко-шаперонным белком синапсов. Ранее было показано, что при скрещивании линии мышей с сверхпродукцией альфа-синуклеина с CSPα нокаутами происходит восстановление фенотипа благодаря участию альфа-синуклеина в синаптической передаче. Поскольку альфа- и гамма-синуклеин структурно похожи, вероятно, что скрещивание CSPα нокаутов с линией мышей со сверхпродукцией гамма-синуклеин даст схожие результаты. В результате было показано, что гамма-синуклеин присутствует в больших количествах в синаптических окончаниях у полученных мышей, однако реверсия фенотипа CSPα нокаутных мышей не происходит, что указывает на отличную от альфа-синуклеина функцию в синапсах. Несмотря на структурное сходство альфа- и гамма-синуклеина, их функции в пресинаптических окончаниях разделены и не дублируются.
CSPα
гамма-синуклеин
нейродегенерация
трансгенные мыши
1. Anwar S., Peters O., Millership S., Ninkina N., Doig N., Connor-Robson N., Threlfell S., Kooner G., Deacon R.M., Bannerman D.M., Bolam J.P., Chandra S.S., Cragg S.J., Wade-Martins R., Buchman V.L. Functional alterations to the nigrostriatal system in mice lacking all three members of the synuclein family // J Neurosci. – 2011. – Vol. 31. – № 20. – P. 7264–74.
2. Buchman V.L., Adu J., Pinon L.G., Ninkina N.N., Davies A.M. Persyn, a member of the synuclein family, influences neurofilament network integrity // Nat Neurosci. – 1998. – Vol. 1. – № 2. – P. 101–3.
3. Buchman V.L., Hunter H.J., Pinon L.G., Thompson J., Privalova E.M., Ninkina N.N., Davies A.M. Persyn, a member of the synuclein family, has a distinct pattern of expression in the developing nervous system // J Neurosci. – 1998. – Vol. 18. – № 22. – P. 9335–41.
4. Burre J., Sharma M., Tsetsenis T., Buchman V., Etherton M.R., Sudhof T.C. Alpha-synuclein promotes SNARE-complex assembly in vivo and in vitro // Science. – 2010. – Vol. 329. – № 5999. – P. 1663–7.
5. Chandra S., Gallardo G., Fernandez-Chacon R., Schluter O.M., Sudhof T.C. Alpha-synuclein cooperates with CSPalpha in preventing neurodegeneration // Cell. – 2005. – Vol. 123. – № 3. – P. 383–96.
6. Fernandez-Chacon R., Wolfel M., Nishimune H., Tabares L., Schmitz F., Castellano-Munoz M., Rosenmund C., Montesinos M.L., Sanes J.R., Schneggenburger R., Sudhof T.C. The synaptic vesicle protein CSP alpha prevents presynaptic degeneration // Neuron. – 2004. – Vol. 42. – № 2. – P. 237–51.
7. Greten-Harrison B., Polydoro M., Morimoto-Tomita M., Diao L., Williams A.M., Nie E.H., Makani S., Tian N., Castillo P.E., Buchman V.L., Chandra S.S. alphabetagamma-Synuclein triple knockout mice reveal age-dependent neuronal dysfunction // Proc Natl Acad Sci U S A. – 2010. – Vol. 107. – № 45. – P. 19573–8.
8. Lavedan C. The synuclein family // Genome Res. – 1998. – Vol. 8. – № 9. – P. 871–80.
9. Ninkina N., Papachroni K., Robertson D.C., Schmidt O., Delaney L., O’Neill F., Court F., Rosenthal A., Fleetwood-Walker S.M., Davies A.M., Buchman V.L. Neurons expressing the highest levels of gamma-synuclein are unaffected by targeted inactivation of the gene // Mol Cell Biol. – 2003. – Vol. 23. – № 22. – P. 8233–45.
10. Ninkina N., Peters O., Millership S., Salem H., van der Putten H., Buchman V.L. Gamma-synucleinopathy: neurodegeneration associated with overexpression of the mouse protein // Hum Mol Genet. – 2009. – Vol. 18. – № 10. – P. 1779–94.
11. Robertson D.C., Schmidt O., Ninkina N., Jones P.A., Sharkey J., Buchman V.L. Developmental loss and resistance to MPTP toxicity of dopaminergic neurones in substantia nigra pars compacta of gamma-synuclein, alpha-synuclein and double alpha/gamma-synuclein null mutant mice // J Neurochem. – 2004. – Vol. 89. – № 5. – P. 1126–36.
12. Ruiz R., Casanas J.J., Sudhof T.C., Tabares L. Cysteine string protein-alpha is essential for the high calcium sensitivity of exocytosis in a vertebrate synapse // Eur J Neurosci. – 2008. – Vol. 27. – № 12. – P. 3118–31.
13. Sharma M., Burre J., Bronk P., Zhang Y., Xu W., Sudhof T.C. CSPalpha knockout causes neurodegeneration by impairing SNAP-25 function // EMBO J. – 2012. – Vol. 31. – № 4. – P. 829–41.
14. Sharma M., Burre J., Sudhof T.C. CSPalpha promotes SNARE-complex assembly by chaperoning SNAP-25 during synaptic activity // Nat Cell Biol. – 2011. – Vol. 13. – № 1. – P. 30–9.
15. Zhang Y.Q., Henderson M.X., Colangelo C.M., Ginsberg S.D., Bruce C., Wu T., Chandra S.S. Identification of CSPalpha clients reveals a role in dynamin 1 regulation // Neuron. – 2012. – Vol. 74. – № 1. – P. 136–50.

Белок CSPα (cysteine string protein) является везикулярным белком синапсов центральной и периферической нервной системы, обладающий ко-шаперонной активностью. CSPα взаимодействует с белками SNARE-комплекса, образование которого является ключевым в процессе нейротрансмиссии [12]. Нарушение функции CSPα препятствует эффективному формированию SNARE-комплексов и приводит к существенному снижению содержания белка SNAP-25 [5; 14]. И хотя CSPα принимает активное участие в целом ряде процессов, связанных с функционированием синаптических везикул и оборотом нейротрансмиттера [15], было выдвинуто предположение, что именно ко-шаперонная способность CSPα поддерживать правильную конформацию и задерживать деградацию белка SNAP-25 в процессах синаптической активности, стимулирует сборку SNARE-комплексов и, таким образом, предотвращает накопление токсичных форм SNARE-белков, имеющих развернутую конформацию, что в свою очередь препятствует синапсов [13–14]. Таким образом, стабилизация SNARE-комплексов и ингибирование процессов деградации белка SNAP-25 являются принципиально важными механизмами защиты синапсов от дегенерации, а поиск факторов, способных стимулировать эти защитные механизмы, рассматривается как перспективное направление разработки патогенетической терапии нейродегенераций. Поэтому исключительно важными представляются данные исследований, проведенных в лаборатории Т. Sudhof [5], в которых было обнаружено, что повышенная экспрессия альфа–синуклеина предотвращает развитие нейродегенеративного процесса, вызванного нарушением функции белка CSPα в модельных мышах. Более того, при выключении гена альфа-синуклеина в генетических нокаутах, отсутствие в нервной системе белка CSPα приводит к еще более стремительному развитию нейродегенеративного процесса у таких двойных нокаутных животных [5]. В линии мышей, у которых генетически инактивирован белок CSPα, развивается агрессивная форма нейродегенеративного процесса с неизбежным летальным исходом. CSPα нокаутные животные погибают в раннем постнатальном периоде с выраженной неврологической симптоматикой [6]. Также было показано, что экспрессия мутантной формы альфа-синуклеина, связанной с наследственными формами болезни Паркинсона, при которых имеет место замена аланина в 30 положении белковой молекулы на фенилаланин, не способна предотвращать развитие нейродегенеративного процесса в CSPα нокаутных мышах, поскольку такая мутантная форма белка не способна эффективно связываться с биологическими мембранами. Таким образом, было установлено, что в нейрональных синапсах альфа-синуклеин и CSPα вовлечены в общий каскадный механизм, при этом маловероятной считается их способность напрямую заменять функцию один другого. Эта гипотеза подтверждается данными Burre с соавторами [4], которые показали, что в мозге модельных животных с инактивацией функции всех трех альфа-, бета- и гамма-синуклеинов обнаруживается повышенный уровень белка CSPα.

Альфа- и гамма-синуклеины имеют исключительно высокую степень гомологии [8]. В работах целого ряда авторов [1; 4–5; 7; 11] независимо было показано, что у модельных животных с нарушенной функцией всех трех синуклеинов с возрастом развивается синаптическая дисфункция, которая не была отмечена ни у альфа-синуклеиновых, ни у бета-синуклеиновых, ни у гамма-синуклеиновых нокаутов, что указывало на принципиальную возможность замещения функции одного синуклеина другим. С другой стороны, альфа- и бета-синуклеины имеют отличную от гамма-синуклеина анатомическую картину экспрессии и обнаруживается в других популяциях центральных и периферических нейронов [3; 9]

Цель: провести сравнительный анализ способности гамма-синуклеина влиять на прогрессию нейродегенерации, обусловленной нарушением функции белка CSP-a в генетически модифицированных мышах.

Материалы и методы исследования

В работе использовали чистые линии животных на генетическом фоне линии C57Bl/6J (Charles River Laboratories, США). Мыши с делецией гена белка CSPα были получены из лаборатории T. Sudhof (Genentech, США) [6]. Линия трансгенных мышей Thy1mγtg была получена из лаборатории V. Buchman [10]. Работы с животными проводили в соответствии с «Правилами лабораторной практики в Российской Федерации» от 2003 г. Геномную ДНК выделяли из биопсии уха животных с помощью набора DiatomTM DNA Prep 200 (ООО «Лаборатория ИзоГен», Россия). Детекцию мутированных аллелей проводили методом полимеразной цепной реакции (ПЦР) с помощью набора GenePak® PCR Core (ООО «Лаборатория ИзоГен», Россия). Для генотипирования потомства от скрещивания мышей трансгенной линии Thy1mγtg с нокаутными мышами линии CSPα–/– проводили идентификацию гомозиготных и гемизиготных по трансгенной кассете особей с использованием ПЦР в реальном времени, которую проводили на установке StepOne Real-Time PCR System (Applied Biosystems, США). При анализе соответствующих последовательностей генов использовали праймеры для CSPα: D (5’ AAAGTCCTATCGGTAAGCAGC), E (5’ CTGCTGGCATACTAATTGCAG), C (5’ GAGCGCGCGCGGCGGAGTTGTTGAC), для трансгенных животных по γ-синуклеину: Psn_up (CCA-TGG-ACG-TCT-TCA-AGA-AAGG), Gsex2_rev (CGT-TCT-CCT-TGG-TTT-TGG-TG). Для постановки иммуноблоттинга использовали следующие антитела: к γ-синуклеину – кроличьи поликлональные, клон SK23 [2], к синаптофизину – мышиные моноклональные, клон 2, BD Transduction Laboratories.

Результаты исследования и их обсуждение

Получение повышенной экспрессии гамма-синуклеина в нервной системе CSPα нокаутных мышей. CSPα нокаутные мыши были скрещены с трансгенными мышами по гену гамма-синуклеина, чтобы создать линию мышей, у которых в геноме отсутствует ген белка CSPα и в то же время на высоком уровне экспрессируется ген белка гамма-синуклеина в нейронах. Для получения такой линии нами была проведена серия скрещиваний CSPα нокаутных мышей с линией трансгенных по гамма-синуклеину мышей [10]. Всех, полученных в первом поколении самок (n = 40) от скрещивания CSPα нокаутных мышей с мышами, трансгенными по гамма-синуклеину, скрещивали с самцами первого поколения. Результатом такого скрещивания является формирование девяти возможных генотипов, которые были определены анализом ДНК из биопсий уха всех потомков методом обычной ПЦР для гена белка CSPα и ПЦР в реальном времени для трансгенной кассеты гамма-синуклеина. В результате генотипирования животных (n = 279), полученных во втором поколении, были идентифицированы потомки со следующими генотипами:

CSPα+/+ / Thy1mγWT/WT - 19 особей; CSPα+/+ / Thy1mγtg/WT - 35 особей; CSPα+/- / Thy1mγWT/WT - 41 особь; CSPα+/- / Thy1mγtg/WT - 69 особей; CSPα+/+ / Thy1mγtg/tg - 33 особи; CSPα+/- / Thy1mγtg/tg - 14 особей; CSPα-/- / Thy1mγWT/WT - 23 особи; CSPα-/- / Thy1mγ tg /WT - 29 особей; CSPα-/- / Thy1mγtg/tg - 16 особей.

В результате проведенных скрещиваний нами было получено 16 особей с генотипом CSPα–/– / Thy1mγ tg/tg, что составляет 5,7 % от общего числа (n = 279) прогенотипированных, выживших до половозрелого возраста потомков и соответствует ожидаемому количеству при менделевском типе наследования.

Повышенная экспрессия экзогенного гамма-синуклеина в нервной системе CSPα нокаутных мышей не влияет на прогрессию нейродегенеративного процесса. Нокаутные по гену белка CSPα мыши прекращали расти и набирать вес между 10 и 20 днями постнатального периода, в отличие от контрольных мышей дикого типа. С этого момента общее состояние нокаутных животных постепенно ухудшалось и, начиная с трехнедельного возраста, регистрировалась их гибель. Около половины всех нокаутных по CSPα мышей не доживали до 35-го постнатального дня, а к 52-му дню погибали все животные. Чтобы определить, будет ли сверхэкспрессия гамма-синуклеина в нокаутных мышах по CSPα влиять на выживаемость этих мышей, мы создали когорты животных дикого типа (WT) и нокаутных CSPα мышей, экспрессирующих высокий уровень гамма-синуклеина в нейронах, благодаря наличию трансгенного аллеля Thy1mγ в их геноме в гомозиготном состоянии, то есть получили экспериментальные группы животных с генотипами: CSPα–/– / Thy1mγtg и CSPα+/+ / Thy1mγtg. Далее мы исследовали фенотипы мышей полученных линий, регистрируя вес в раннем постнатальном периоде и продолжительность жизни. Мыши с генотипом CSPα+/+ / Thy1mγtg набирали вес и развивались нормально и не отличались от контрольных животных C57Bl/6J дикого типа в течение первых двух месяцев постнатального развития. Смертность этих животных в этом периоде была наравне с таковыми в контрольных группах животных дикого типа линии C57Bl/6J, которых содержали в таких же условиях. Мыши линии CSPα–/– / Thy1mγtg, напротив, не набирали вес, начиная с 10 дня постнатального периода так же, как мыши линии CSPα–/– , не несущие трансгенную кассету гамма-синуклеина. На этой стадии мыши обеих групп становились постепенно апатичными, хотя способны были реагировать в ответ на внешний раздражитель. Причем это было показано как для самцов, так и самок (таблица).

Масса тела животных разных генотипов в раннем постнатальном периоде, X±m

Дни

WT♀

Thy1mγtg♀

CSPα–/–♀

CSPα–/–/ Thy1mγtg♀

WT♂

Thy1mγtg♂

CSPα–/–♂

CSPα–/–/ Thy1mγtg♂

10

4,98 ± 0,2

4,71 ± 0,3

4,70 ± 0,1

4,41 ± 0,2

4,74 ± 0,1

4,92 ± 0,2

4,57 ± 0,2

4,67 ± 0,1

20

7,67 ± 0,3

7,30 ± 0,3

5,32 ± 0,3

5,93 ± 0,4

7,98 ± 0,2

7,25 ± 0,2

6,91 ± 0,4

6,09 ± 0,2

30

14,16 ± 0,2

13,8 ± 0,7

5,47 ± 0,5

6,43 ± 0,3

16,83 ± 0,1

15,98 ± 1,1

7,13 ± 0,4

6,25 ± 0,2

40

17,36 ± 0,1

17,28 ± 0,7

6,81 ± 0,2

6,28 ± 0,6

21,0 ± 0,3

20,54 ± 0,8

7,56 ± 0,2

6,58 ± 0,3

50

19,09 ± 0,5

18,75 ± 0,7

6,90 ± 0,2

7,25 ± 0,1

23,12 ± 0,4

23,65 ± 0,5

7,34 ± 0,1

6,48 ± 0,7

60

21,01 ± 0,3

20,47 ± 0,9

7,23 ± 0,1

27,34 ± 0,1

26,41 ± 0,5

±

7,01 ± 0,5

Генотипы: WT (wild type) – контрольная группа с немодифицированным геномом; Thy1mγtg – линия трансгенных мышей со сверхэкспрессией гамма-синуклеина; CSPα–/– – нокаутные мыши по CSPα, CSPα–/– / Thy1mγtg – нокаутные мыши по CSPα со сверхэкспрессией гамма-синуклеина (масса в граммах, X – средняя арифметическая; m – ошибка средней арифметической).

Статистически значимых отличий в возрасте наступления смерти между животными групп CSPα–/– / Thy1mγtg и CSPα–/– выявлено не было. Так же, как и в группе CSPα–/– мышей, 50 % мышей линии CSPα–/– / Thy1mγtg погибали к 35 постнатальному дню и к 50 дню погибали почти все мыши (рис. 1).

Таким образом, показатели динамики постнатального развития мышей CSPα–/–  / Thy1mγtg, которое было охарактеризовано регулярной регистрацией массы тела животных, не отличались от показателей линии нокаутных по CSPα мышей с нормальной экспрессией гамма-синуклеина.

Анализ уровня гамма-синуклеина в синаптических везикулах CSPα–/–  / Thy1mγtg мышей. Ранее было установлено, что увеличение внутриклеточной концентрации альфа-синуклеина, причем не только в синапсах, но и в цитоплазме нейронов, путем его эктопической экспрессии позволяет остановить нейродегенеративный процесс, вызванный недостаточностью функции белка CSPα, участвующего в образовании SNARE-комплекса при нейротрансмиссии [5]. Для того чтобы оценить, влияет ли сверхэкспрессия гамма-синуклеина на синаптическую дисфункцию, причиной которой является отсутствие в геноме ко-шаперонного белка CSPα, очень важным представлялся вопрос, достаточно ли высокая концентрация эктопического гамма-синуклеина в синапсах полученных нами мышей. То, что уровень эктопического гамма-синуклеина высок в телах и в отростках нейронов, ранее было показано в работах, посвященных анализу этой линии мышей [10]. Однако не было показано наличие эктопического гамма-синуклеина в синапсах. Для того чтобы доказать, что гамма-синуклеин присутствует в синапсах в повышенном количестве у трансгенных мышей, мы анализировали с помощью иммуноблоттинга белковые фракции печени, коры головного мозга, спинного мозга, а также синаптосомальную и везикулярную фракции (выделенные из полосатого тела мозга) девятимесячных мышей дикого типа и трансгенных по гену гамма-синуклеина. В результате мы показали, что гамма-синуклеин действительно присутствует в больших количествах во фракции синаптических везикул и в грубой синаптосомальной фракции. Также мы показали, что эктопический гамма-синуклеин экспрессировался исключительно в нервной ткани. В контрольных препаратах, полученных от мышей дикого типа, его количество было существенно ниже, поскольку там присутствовал только эндогенный гамма-синуклеин (рис. 2).

pic_38.tif

Рис. 1. Процент выживших животных разных генотипов в различные периоды постнатального развития

pic_39.tif

Рис. 2. Детекция эктопического гамма-синуклеина в лизатах нервной ткани и печени Thy1mγtg мышей: ТГ – трансгенные мыши; ДТ – дикий тип, контрольная группа с немодифицированным геномом

В данном эксперименте в качестве контроля был выбран синаптофизин – синаптический белок, который использовали для нормализации значений тотального синаптического белка в исследуемых образцах.

Таким образом, можно сделать вывод, что высокие количества гамма-синуклеина в синапсах не обеспечивают реверсию фенотипа CSPα нокаутных мышей, и этим он отличается от альфа-синуклеина. Несмотря на структурные сходства между альфа- и гамма-синуклеином, их функции в пресинаптических окончаниях разделены и не дублируются.

Рецензенты:

Кинзирский А.С., д.м.н., профессор, заведующий лабораторией фармакологии, Институт физиологически активных веществ РАН, г. Черноголовка;

Григорьев В.В., д.б.н., заведующий лабораторией нейрорецепции, Институт физиологически активных веществ РАН, г. Черноголовка.

Работа поступила в редакцию 30.04.2014.

Библиографическая ссылка

Лыткина О.А., Тарасова Т.В., Анохин П.К., Кухарский М.С., Устюгов A.A., Бачурин С.О. ИССЛЕДОВАНИЕ ЭФФЕКТА ПОВЫШЕННОГО ОБРАЗОВАНИЯ ГАММА-СИНУКЛЕИНА НА ДЕГЕНЕРАЦИЮ СИНАПСОВ, ВЫЗВАННУЮ НАРУШЕНИЕМ ФУНКЦИИ БЕЛКА CSPα // Фундаментальные исследования. – 2014. – № 6-6. – С. 1214-1218;
URL: http://www.fundamental-research.ru/ru/article/view?id=34316 (дата обращения: 07.12.2019).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074