Научный журнал
Фундаментальные исследования
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,118

ЭКСПРЕССИЯ СИЛИКАТЕИНОВ НА МОДЕЛЬНОЙ КЛЕТОЧНОЙ КУЛЬТУРЕ ПРИММОРФ БАЙКАЛЬСКОЙ ГУБКИ LUBOMIRSKIA BAICALENSIS

Черногор Л.И. 1 Кондратов И.Г. 1 Кулакова Н.В. 1 Деникина Н.Н. 1 Беликов С.И. 1
1 ФГБУН «Лимнологический институт» Сибирского отделения Российской академии наук
Проведен анализ влияния индукции силикатом натрия модельной клеточной культуры примморф байкальской губки Lubomirskia baicalensis на экспрессию силикатеинов и морфогенез спикул. Клеточную культуру примморф истощали по содержанию кремния путем культивирования на искусственной байкальской воде в течение месяца. Экспрессию генов белков, регулирующих метаболизм кремния, индуцировали добавлением силиката натрия до конечной концентрации 70 мкМ. Уровень экспрессии генов силикатеинов анализировали методом ПЦР в реальном режиме времени в первый, второй, третий и шестой дни после индукции. В качестве референсных генов для нормализации данных использовали β-актин (ACTB) и фактор элонгации 1 α (eEF1a1). Контрольными образцами служили пробы взрослой губки и образцы примморф, культивированных на натуральной и искусственной байкальской воде до индукции. Динамику образования и рост кремниевых спикул анализировали методами микроскопии. Образцы примморф, индуцированных добавлением силиката натрия, на фоне массового развития спикул не продемонстрировали значительного увеличения уровня экспрессии генов силикатеинов по сравнению с другими образцами (расхождение 1,7–2 относительных единиц). Такие значения не могут считаться статистически значимыми изменениями в степени экспрессии и лежат в пределах погрешности, что говорит о практически полном отсутствии индукции синтеза мРНК силикатеинов силикатом натрия. Этот факт свидетельствует о пассивности силикатеинов на начальных этапах метаболизма кремния и необходимости поиска других соединений, влияющих на отложение биогенного кремнезема в спикулах губок.
примморфы
кремниевые спикулы
экспрессия силикатеинов
Lubomirskia baicalensis
1. Калюжная О.В., Беликова А.С., Подольская Е.П., Красько А.Г., Muller W.E.G., Беликов С.И. Идентификация силикатеинов пресноводной губки Lubomirskia baicalensis // Молекулярная биология. – 2007. – т. 41. – № 4. – С. 616–623.
2. Кондратов И.Г., Соловаров И.С., Деникина Н.Н., Лопатовская О.Г., Беликов С.И. Выделение и идентификация нового белка из спикул пресноводной губки Baicalospongia bacillifera // Известия ИГУ. Серия ‘Биология. Экология’. – 2012. – т. 5.– № 4. – С. 147–151.
3. Cha J.N., Shimizu K., Zhou Y., Christianssen S.C., Chmelka B.F., Stucky G.D., Morse D.E. Silicatein filaments and subunits from a marine sponge direct the polymerization of silica and silicones in vitro // Proc Natl Acad Sci U S A. – 1999. – Vol. 96, № 2. – P. 361–365.
4. Chernogor L.I., Denikina N.N., Belikov S.I., Ereskovsky A.V. Long-term cultivation of primmorphs from freshwater Baikal sponges Lubomirskia baikalensis // Marine Biotechnology. – 2011. – Vol. 13, № 4. – P. 782–792.
5. Chernogor L.I., Denikina N.N., Belikov S.I., Ereskov sky A.V. Formation of spicules during the long-term cultivation of primmorphs from the freshwater Baikal sponge Lubomirskia baikalensis // Organic Chem Current Res, 2011; available at: http://dx.doi.org/10.4172/2161-0401.S2-001
6. Custodio M.R., Prokic I., Steffen R., Koziol C., Borojevic R., Brummer F., Nickel M., Müller W.E.G. Primmorphs generated from dissociated cells of the sponge Suberites domuncula: a model system for studies of cell proliferation and cell death // Mech Ageing Dev. – 1998. – Vol. – 105. – P. 45–59.
7. Jones W.C. Spicule dimensions as taxonomic criteria in the identification of haplosclerid sponges from the shores of Anglesey // Zoological Journal of the Linnean Society. – 1984. – Vol. 80. – P. 239–259.
8. Mohri K., Nakatsukasa M., Masuda Y., Agata K., Funayama N. Toward Understanding the morphogenesis of siliceous spicules in freshwater sponge: differential mRNA expression of spicule-type-specific silicatein genes in Ephydatia fluviatilis // Dev Dyn. – 2008. – Vol. 237. – P. 3024–3039.
9. Morse D.E. Silicon biotechnology: harnessing biological silica production to construct new materials // Trends Biotechnology. – 1999. – Vol. 17. – P. 230–232.
10. Müller W. E.G., Boreiko A., Wang X., Belikov S.I., Wiens M., Grebenjuk V.A., Schlosmacher U., Schroder H.C. Silicateins, the major biosilica forming enzymes present in demosponges: Protein analysis and phylogenetic relationship // Gene. – 2007. – Vol. 395. – P. 62–71.
11. Pomponi S.A. Biology of the Porifera: cell culture // Can J Zool. – 2006. – Vol. 84. – P. 167–174.
12. Schröder H.C., Perović-Ottstadt S., Rothenberger M., Wiens M., Schwertner H., Batel R., Korzhev M., Müller I.M., Müller W.E.G. Silica transport in the demosponge Suberites domuncula: fluorescence emission analysis using the PDMPO probe and cloning of a potential transporter // Biochem J. – 2004. – Vol. 381. – P. 665–673.
13. Simpson T.L.; Volcani B.E. Silicon and siliceous structures in biological systems; Springer-Verlag: New York, 1981. 404 p.
14. Simpson T.L. The cell biology of sponges. Springer-Verlag, New York, NY, 1984. 627 p.

Процесс отложения биогенного кремнезема (гидратированный кварц (SiO2×nH2O)n) широко распространен в природе как у простейших, так и у многоклеточных организмов [13]. Одним из наиболее ярких представителей животных, формирующих кремниевый скелет, являются губки классов Hexactinellida и Demospongiae. Структурными элементами скелета губок являются спикулы – цилиндрические белково-кварцевые образования видоспецифичной формы, скрепленные аналогом коллагена – спонгином [14]. Основными белковыми компонентами спикул губок класса Demospongiae являются силикатеины [9]. Результаты исследований влияния силикатеинов на процесс полимеризации кремниевой кислоты in vitro, а также разнообразия генов силикатеинов у губок и их дифференциальной экспрессии in vivo позволили выдвинуть гипотезу о ключевой роли этих белков в процессе спикулогенеза [3, 8, 10, 12]. Однако, поскольку интерпретация данных, полученных в экспериментах in vivo, значительно затруднена, а анализ in vitro не позволяет корректно оценить степень участия силикатеинов в формировании спикул в живом организме губки, было принято решение использовать в качестве модели трехмерную клеточную культуру губок – примморф [6]. Примморфы являются промежуточным звеном между единичной клеткой и полноценной губкой и могут служить удобной моделью ex vivo для решения многих проблем физиологии, клеточной и молекулярной биологии [6, 11].

У пресноводной губки Lubomirskia baiсalensis (Demospongiae) к настоящему времени идентифицированы четыре силикатеина альфа и определены последовательности их генов [1]. Кроме того, нами разработаны условия получения и длительного культивирования клеточной культуры примморф ex vivo [4].

Цель работы – оценить влияние индукции силикатом натрия клеточной культуры примморф байкальской губки L. baiсalensis на экспрессию генов силикатеинов в процессе спикулогенеза.

Материалы и методы исследования

Губки L. baiсalensis собирали в ноябре 2013 г. с помощью водолазного снаряжения в оз. Бaйкал на глубинах от 10 до 20 м в районе п. Листвянка и Большие Коты. Образцы губок транспортировали при температуре 3–4 °С. Примморфы получали по ранее разработанной методике [4]. Полученные примморфы культивировали в 24-луночных пластиковых планшетах (Nalge Nunc International) в натуральной байкальской воде (НБВ) и искусственной байкальской воде (ИБВ) при 3–6 °С и естественном световом режиме с доступом кислорода в течение 1 месяца [4]. Затем часть культивированных на ИБВ примморф индуцировали добавлением силиката натрия до конечной концентрации 70 мкМ. После индукции в первый, второй, третий и шестой дни примморфы размером 3–5 мм в диаметре отбирали в количестве 20 штук в 5 повторах для последующей экстракции РНК. В качестве контроля отбирали примморфы, культивированные на НБВ и ИБВ без индукции силикатом натрия. За динамикой образования и ростом кремниевых спикул вели ежедневное прижизненное наблюдение с помощью светового флуоресцентного микроскопа AxioCam MRM (Zeiss, Германия), для детального рассмотрения спикул использовали сканирующий электронный микроскоп SEM 525M (Philips, Holland) по опубликованной методике [5]. Кроме того, ежедневно на предметных слайдах готовили препараты спикул, количество которых определяли с помощью калиброванных окуляров с увеличением 200× с помощью оптического микроскопа (XDS-1B, COIC), просматривая не менее 10 полей зрения, в соответствии с ранее описанными методами [7]. Дополнительно были сделаны снимки с помощью цифрового фотоаппарата Panasonic DMC-FZ3. В ходе данного эксперимента было обработано более 500 штук примморф, размером 2–5 мм в диаметре.

Суммарную РНК из примморф и взрослой губки выделяли с использованием Trizol (Life Science, США), обрабатывали ДНКазой 1, свободной от РНКаз (Thermo Fisher Scientific) и проводили реакцию обратной транскрипции с набором First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) в соответствии с инструкциями производителей. Полученные образцы кДНК использовали в качестве матриц при проведении ПЦР в реальном времени с неспецифической детекцией iQ SYBR Green Supermix (BioRad, USA) на амплификаторе Rotor-Gene 6000 (QIAGEN). Референсными последовательностями в анализе были housekeeping-гены: β-актин (ACTB) и фактор элонгации 1 α (eEF1a1). Пары праймеров для детекции генов силикатеина, ACTB и eEF1a1 разработали на основе ранее опубликованных последовательностей (GenBank: AJ968947; AJ968946; AJ968945; AJ872183) и собственных данных:

Silf 5’AGTCACAGGGTCAGTGTGG / Silr 5’CATCACCACCACTGCAACC;

qActf 5’ACTGGGACGACATGGAGAAG / qActr 5’TGGCTAGGGTGTTGAAGGTC;

qEf1af 5’GCAGCTAATCGTTGGTGTCA / qEf1ar 5’GTAGGTCGGTGCTTCTCTCG.

Они позволяют амплифицировать фрагменты генов силикатеинов, ACTB и eEF1a1 длиной 159, 162 и 188 п.н. соответственно.

Результаты исследования и их обсуждение

Долгоживущая культура примморф губок является важным инструментом в анализе белков и генов, вовлеченных в процесс метаболизма интересующих исследователя соединений. Она позволяет проводить в контролируемых условиях индукцию синтеза мРНК, кодирующих целевые белки, с одновременным контролем морфологических параметров. Объектом настоящего исследования служила культура примморф пресноводной эндемичной байкальской губки L. baicalensis (Porifera, Demospongiae, Lubomirskiidae), являющаяся хорошим модельным объектом для прикладных исследований, в частности изучения метаболизма кремния, благодаря своим культуральным характеристикам.

После диссоциации клеток губки L. baiсalensis в течение первого дня отдельные клетки собирались вместе и формировалась клеточная культура примморф ex vivo. Примморфы образовывали конгломераты неправильной формы с неровной поверхностью, которые постепенно становились сферическими. Через 1–2 дня молодые примморфы имели сферическую форму до 2 мм в диаметре и ровный гладкий эпителий (рис. 1).

pic_72.tif 

Рис. 1. Культура примморф, полученная из байкальской губки L. baicalensis. Масштаб изображения 1 мм

При культивировании примморф на НБВ отмечен интенсивный рост спикул в течение всего эксперимента. Количество спикул составило 40–50 на 10 полей зрения в каждом образце (рис. 2, A).

С целью получения максимально истощенной по кремнию культуры для изучения индуцированного спикулогенеза часть примморф культивировали на ИБВ в течение месяца. При этом активного образования молодых спикул не отмечали, на 10 полей зрения обнаруживали 2–10 спикул (рис. 2, Б). После добавления силиката натрия на 2 день наблюдали образование и рост ювенильных спикул. На шестой день после индукции на 10 полей зрения определили до 100 и более спикул для каждого образца (рис. 2, В).

Молодые спикулы были тонкими, хрупкими и гладкими, а затем по мере роста на них образовывались шипики. Спикулы в контрольном образце взрослой губки L. baiсalensis незначительно отличались от спикул, образовавшихся в примморфах, они также были изогнуты и покрыты шипиками (рис. 3 А, Б).

pic_73.tif 

Рис. 2. Световая микроскопия образования кремниевых спикул при культивировании клеточной культуры примморф на 6 день на различных средах: А – образование спикул на НБВ; B – образование спикул на ИБВ; С – образование спикул при индукции силикатом натрия. Масштаб изображения 60 μm

pic_74.tif 

Рис. 3. СЭМ микроскопия кремниевых спикул из взрослой губки L. baiсalensis (А) и примморф после индукции силикатом натрия (Б). Масштаб изображения: 20 μm

Для анализа влияния увеличения концентрации солей кремниевой кислоты на уровень экспрессии генов силикатеинов с помощью PCR в реальном времени использовали образец взрослой губки (контрольный базовый уровень in vivo), образцы культивированных на НБВ примморф (контрольный базовый уровень ex vivo), примморф, культивированных на ИБВ (экспериментальный истощенный уровень ex vivo), и примморф, индуцированных силикатом натрия на первый, второй, третий и шестой дни индукции (экспериментальные уровни индукции ex vivo). Несмотря на то, что интенсивность образования спикул во всех образцах существенно отличалась, различия в количестве специфичной мРНК силикатеинов отмечены не были. Образцы примморф, индуцированных добавлением силиката натрия, не продемонстрировали роста дельта Ct для генов силикатеинов по сравнению с другими образцами на фоне массового развития спикул. Определение уровня экспрессии генов силикатеинов относительно референс-генов актина и фактора элонгации eEF1a1 осуществляли для каждого препарата кДНК по методу дельта дельта Ct. Уровень экспрессии мРНК силикатеинов претерпевал незначительные изменения и составлял 1,7–2 относительных единиц. Такие значения не могут считаться статистически значимыми изменениями в уровне экспрессии, так как лежат в пределах погрешности, что говорит о практически полном отсутствии индукции синтеза мРНК силикатеинов при индукции спикулогенеза силикатом натрия.

Заключение

Таким образом, результаты проведенных экспериментов показали, что уровень экспрессии генов силикатеинов в байкальских губках напрямую не зависит от увеличения концентрации солей кремниевой кислоты, которое стимулирует образование кремнистых спикул. По-видимому, силикатеины непосредственно не связаны с отложением биогенного кремнезема и не принимают активного участия в начальных этапах метаболизма кремния. Можно предположить, что гены силикатеинов активизируются на более поздних стадиях спикулогенеза, а начало процесса контролируют другие белки, которые либо остаются в теле клетки и не детектируются в составе спикул, либо откладываются затем в спикулах в виде комплекса с кремнеземом [2]. Поиск таких белков или других биологически активных соединений, отвечающих за отложение биогенного кремнезема, остается насущ ной задачей.

Работа выполнена в рамках проекта VI.50.1.4 «Молекулярная экология и эволюция живых систем Центральной Азии на примере рыб, губок и ассоциированной с ними микрофлоры», № гос. рег. 01201353444 при частичной финансовой поддержке гранта РФФИ № 13-04-00482.

Рецензенты:

Огарков О.Б., д.м.н., зав. лабораторией эпидемически и социально значимых инфекций, ФГБНУ НЦ «Проблем здоровья семьи и репродукции человека» ФАНО, г. Иркутск;

Астафьев В.А., д.м.н., профессор, ведущий научный сотрудник лаборатории эпидемически и социально значимых инфекций, ФГБНУ НЦ «Проблем здоровья семьи и репродукции человека» ФАНО, г. Иркутск.

Работа поступила в редакцию 28.11.2014.


Библиографическая ссылка

Черногор Л.И., Кондратов И.Г., Кулакова Н.В., Деникина Н.Н., Беликов С.И. ЭКСПРЕССИЯ СИЛИКАТЕИНОВ НА МОДЕЛЬНОЙ КЛЕТОЧНОЙ КУЛЬТУРЕ ПРИММОРФ БАЙКАЛЬСКОЙ ГУБКИ LUBOMIRSKIA BAICALENSIS // Фундаментальные исследования. – 2014. – № 11-11. – С. 2455-2459;
URL: http://www.fundamental-research.ru/ru/article/view?id=35965 (дата обращения: 24.10.2018).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.252